Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   Cspg2
Linkage Group   :   2
Position(cM)   :   87.6
Marker Number   :   407
Forward Primer   :  
GACAGCAGTGGAGACAGATGAAGAAC
Reverse Primer   :  
TCTACAGCGACGGGAGATGACG
Expected Product Length   :   708
Annealing Temperature :   55
SNP Detection Method :   RD-RsaI
Contig : 
Stigson, unpublished data





Acknowledgements   Citation   Disclaimer