Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   Dlx3
Linkage Group   :   11
Position(cM)   :   149.6
Marker Number   :   412
Forward Primer   :  
GGCGAGGCGCACCTCTCCAACTGGTGA
Reverse Primer   :  
AGGCTCCCACCTTCTGAGTTGGGAAGG
Expected Product Length   :   218
Annealing Temperature :   55
SNP Detection Method :   RD-DpnII
Contig : 
gi|1399860|gb|U59480.1|AMU59480





Acknowledgements   Citation   Disclaimer