Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E11G12
Linkage Group   :   1
Position(cM)   :   244.8
Marker Number   :   39
Forward Primer   :  
GTGTGAAACTACCCAACATCACTTAC
Reverse Primer   :  
CCGATCACAGATGTATAAAGAAGAGT
Expected Product Length   :   265
Annealing Temperature :   60
SNP Detection Method :   TGCGE
Contig : 
TIG_Nohits_3433_Contig_1





Acknowledgements   Citation   Disclaimer