Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E11G6
Linkage Group   :   4
Position(cM)   :   362.3
Marker Number   :   43
Forward Primer   :  
ATGATGATTGAACAAACAGACACTTT
Reverse Primer   :  
AAGCAATTAAAACAGTAAAGAAGGGA
Expected Product Length   :   269
Annealing Temperature :   60
SNP Detection Method :   TGCGE
Contig : 
Cluster_153963_Contig1





Acknowledgements   Citation   Disclaimer