Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E12A1
Linkage Group   :   8
Position(cM)   :   36.4
Marker Number   :   47
Forward Primer   :  
ATTTTTCAAGCTCAAAGAGGATTAGA
Reverse Primer   :  
TAAGCTGCATTTTCAAGATGTATTTC
Expected Product Length   :   252
Annealing Temperature :   60
SNP Detection Method :   TGCGE
Contig : 
Mex_Nohits_1356_Contig_1





Acknowledgements   Citation   Disclaimer