Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E12C8
Linkage Group   :   1
Position(cM)   :   780.5
Marker Number   :   68
Forward Primer   :  
GACTGTCATTAGGCATGTTAGTAGGA
Reverse Primer   :  
ATCTGCATATGTCCGATTGTTAGTAG
Expected Product Length   :   216
Annealing Temperature :   55
SNP Detection Method :   ASA
Contig : 
TIG_Nohits_3277_Contig_1





Acknowledgements   Citation   Disclaimer