Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E17G4
Linkage Group   :   6
Position(cM)   :   186.7
Marker Number   :   216
Forward Primer   :  
AGATATTTCAGGAGAAAAGGAAGTGA
Reverse Primer   :  
TGTTTGTGGCATTAAAACAAAACTAT
Expected Product Length   :   222
Annealing Temperature :   55
SNP Detection Method :   TGCGE
Contig : 
Cluster_262971_Contig2





Acknowledgements   Citation   Disclaimer