Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E20G10
Linkage Group   :   2
Position(cM)   :   293.2
Marker Number   :   274
Forward Primer   :  
GAGCTCCAAACTATAACTGAAGAACC
Reverse Primer   :  
GCTCACAAAATGCAAGATTAACTAAC
Expected Product Length   :   207
Annealing Temperature :   55
SNP Detection Method :   TGCGE
Contig : 
Cluster_287412_Contig1





Acknowledgements   Citation   Disclaimer