Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E22A4
Linkage Group   :   10
Position(cM)   :   109
Marker Number   :   804
Forward Primer   :  
GACCTTTATCTGGAACTGATTGAGTA
Reverse Primer   :  
TAAGTATTGCTGGGTTATGTGGTATG
Expected Product Length   :   400
Annealing Temperature :   55
SNP Detection Method :   ASA
Contig : 
TIG_NM_003617_Contig_1





Acknowledgements   Citation   Disclaimer