Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E23E11
Linkage Group   :   6
Position(cM)   :   241
Marker Number   :   878
Forward Primer   :  
GTCTCCTCCACTCCGTAGCC
Reverse Primer   :  
GTCTATGCGCTCGAGTCACC
Expected Product Length   :   228
Annealing Temperature :   60
SNP Detection Method :   ASA
Contig : 
TIG_NM_022157_Contig_1





Acknowledgements   Citation   Disclaimer