Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E24C2
Linkage Group   :   10
Position(cM)   :   6.4
Marker Number   :   887
Forward Primer   :  
GTTCCAAAGAATTACAAGTTGGTAGC
Reverse Primer   :  
TGGAATACAAGTGGATAACCAAGTAA
Expected Product Length   :   426
Annealing Temperature :   55
SNP Detection Method :   TGCGE
Contig : 
TIG_NM_007006_Contig_1





Acknowledgements   Citation   Disclaimer