Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E24C6
Linkage Group   :   1
Position(cM)   :   66.7
Marker Number   :   888
Forward Primer   :  
CTGTTCTATTGAGTGGTTTCACTTCG
Reverse Primer   :  
GTAGAGCTGAAATTGATACCTTGTCA
Expected Product Length   :   424
Annealing Temperature :   50
SNP Detection Method :   TGCGE
Contig : 
TIG_NM_016162_Contig_1





Acknowledgements   Citation   Disclaimer