Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E26C11
Linkage Group   :   5
Position(cM)   :   281.3
Marker Number   :   895
Forward Primer   :  
CTTTGAACTGAGACCGGACC
Reverse Primer   :  
TGCAGAATGATGCCAGCAG
Expected Product Length   :   216
Annealing Temperature :   60
SNP Detection Method :   TGCGE
Contig : 
TIG_NM_000785_Contig_1





Acknowledgements   Citation   Disclaimer