Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E27A3
Linkage Group   :   9
Position(cM)   :   5.1
Marker Number   :   896
Forward Primer   :  
AGATGATTAAGGCGACCCATATTACT
Reverse Primer   :  
GCCACAAGAAAACCAGAAAGTATAAA
Expected Product Length   :   410
Annealing Temperature :   60
SNP Detection Method :   ASA
Contig : 
TIG_NM_002822_Contig_1





Acknowledgements   Citation   Disclaimer