Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   E8E5
Linkage Group   :   4
Position(cM)   :   408.1
Marker Number   :   365
Forward Primer   :  
CAGGAAACTATGTGCAGAAGATCTAA
Reverse Primer   :  
GTTTCTCCAGTAGTAGGATGTGCCT
Expected Product Length   :   214
Annealing Temperature :   60
SNP Detection Method :   TGCGE
Contig : 
Cluster_296127_Contig1





Acknowledgements   Citation   Disclaimer