Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   ETG1506
Linkage Group   :   11
Position(cM)   :   168.2
Marker Number   :   416
Forward Primer   :  
AGGATATCCGCTCAGAAATATGAAG
Reverse Primer   :  
CTGACCACTTGCAAAACTTACTACCT
Expected Product Length   :   326
Annealing Temperature :   55
SNP Detection Method :   RD-Fnu4HI
Contig : 
Cluster_170582_Contig1





Acknowledgements   Citation   Disclaimer