Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   G1D6
Linkage Group   :   6
Position(cM)   :   308.6
Marker Number   :   420
Forward Primer   :  
CAGCGTGCCCACCCGATAGAA
Reverse Primer   :  
TCCCAAAAAGTAAAATGTGCAAAGAAAA
Expected Product Length   :   364
Annealing Temperature :   55
SNP Detection Method :   RD-TaqI
Contig : 
Cluster_331100_Contig1





Acknowledgements   Citation   Disclaimer