Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   G1L7
Linkage Group   :   2
Position(cM)   :   47
Marker Number   :   428
Forward Primer   :  
GTGCTACAGGAAGGAATGGATG
Reverse Primer   :  
TAGCACAGGAACAGCCGACAATAA
Expected Product Length   :   260
Annealing Temperature :   55
SNP Detection Method :   RD-DdeI
Contig : 
Mex_Nohits_2377_Contig_1





Acknowledgements   Citation   Disclaimer