Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   G2F2
Linkage Group   :   6
Position(cM)   :   158
Marker Number   :   430
Forward Primer   :  
CACACCACAGACGCATTGAC
Reverse Primer   :  
TCCCCAGCCTGTGTAGAAC
Expected Product Length   :   302
Annealing Temperature :   55
SNP Detection Method :   RD-TaqI
Contig : 
Mex_Nohits_1034_Contig_1





Acknowledgements   Citation   Disclaimer