Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   G2H18
Linkage Group   :   11
Position(cM)   :   137.2
Marker Number   :   434
Forward Primer   :  
TTGTCAAATGGGCGAGTTCA
Reverse Primer   :  
TGTTTTGCACCCAGTTTTTG
Expected Product Length   :   240
Annealing Temperature :   55
SNP Detection Method :   RD-Tsp509I
Contig : 
Cluster_99683_Contig1





Acknowledgements   Citation   Disclaimer