Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   G2I16
Linkage Group   :   1
Position(cM)   :   815.5
Marker Number   :   435
Forward Primer   :  
CTTCCTTCCTTCGAGCTGGTGTCTA
Reverse Primer   :  
TGAGGTGCATGATGGTCTTTG
Expected Product Length   :   195
Annealing Temperature :   55
SNP Detection Method :   RD-BsuRI
Contig : 
Cluster_315227_Contig1





Acknowledgements   Citation   Disclaimer