Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   GNAT1
Linkage Group   :   3
Position(cM)   :   171.6
Marker Number   :   441
Forward Primer   :  
CCCATGCTGCGGAAGAGA
Reverse Primer   :  
TTAGAGGGCGAAAAAGTGTCATC
Expected Product Length   :   503
Annealing Temperature :   55
SNP Detection Method :   RD-DraI
Contig : 
gi|3789977|gb|AF050653.1|AF050653





Acknowledgements   Citation   Disclaimer