Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   Pdgf
Linkage Group   :   2
Position(cM)   :   -
Marker Number   :   458
Forward Primer   :  
CGGGTCATTGAGTCCATCAGCC
Reverse Primer   :  
CAGTGGGTTTTAACATTTTCACAG
Expected Product Length   :   1000
Annealing Temperature :   55
SNP Detection Method :   RD-RsaI
Contig : 
Parichy et al, 1999





Acknowledgements   Citation   Disclaimer