Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   Rho
Linkage Group   :   3
Position(cM)   :   111.9
Marker Number   :   459
Forward Primer   :  
CCAAGAGTTCTGCCATCTACAATCCAG
Reverse Primer   :  
CGCAGGAGAAACCTGGCTGGAAGACAC
Expected Product Length   :   178
Annealing Temperature :   55
SNP Detection Method :   ASA
Contig : 
gi|1477471|gb|U36574.1|ATU36574





Acknowledgements   Citation   Disclaimer