Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   Slc4a5
Linkage Group   :   2
Position(cM)   :   235.3
Marker Number   :   461
Forward Primer   :  
TCCGCTTGCAGCAGTCTCCTTGCTCTC
Reverse Primer   :  
TAACGGCCTGATTGATGACCAGCGAAG
Expected Product Length   :   223
Annealing Temperature :   55
SNP Detection Method :   SSCP
Contig : 
gi|2198814|gb|AF001958.1|AF001958





Acknowledgements   Citation   Disclaimer