Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   UV
Linkage Group   :   9
Position(cM)   :   170.1
Marker Number   :   466
Forward Primer   :  
GAAGCGAGGTCTGCAAGGAGGATG
Reverse Primer   :  
TACCGCAAGGAAATGGGAAGCAGT
Expected Product Length   :   302
Annealing Temperature :   55
SNP Detection Method :   RD-RsaI
Contig : 
gi|4027888|gb|AF038948.1|AF038948





Acknowledgements   Citation   Disclaimer