Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   Wnt5B
Linkage Group   :   9
Position(cM)   :   58.1
Marker Number   :   471
Forward Primer   :  
TGCACGCTTCCACACCTTCCTCTA
Reverse Primer   :  
GCGCGGCCCAGCAGTAAACC
Expected Product Length   :   382
Annealing Temperature :   55
SNP Detection Method :   RD-BglII
Contig : 
gi|62428|emb|Z14048.1|AMWNT5B





Acknowledgements   Citation   Disclaimer