Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   bl005ba01
Linkage Group   :   4
Position(cM)   :   392.9
Marker Number   :   399
Forward Primer   :  
GACAGGTCATGAACTTTTGAAAATAA
Reverse Primer   :  
AAAGTATATGTACCAAATGGGAGAGC
Expected Product Length   :   214
Annealing Temperature :   55
SNP Detection Method :   RD-HpaII
Contig : 
Cluster_415929_Contig1





Acknowledgements   Citation   Disclaimer