Sal-site: An integrated webportal for the Ambystoma Research Community
Ambystoma EST Database Ambystoma Gene Collection
Ambystoma Map & Marker Collection Ambystoma Microarray Database
BLAST the Ambystoma EST database

Marker Information

Maker Name   :   nt001cb10
Linkage Group   :   1
Position(cM)   :   734.6
Marker Number   :   454
Forward Primer   :  
TGTGTTCAGTTTAAAATTTTGTTTCA
Reverse Primer   :  
TCTTTACCAAGTTCTCCTTTGAAAAT
Expected Product Length   :   277
Annealing Temperature :   55
SNP Detection Method :   RD-MseI
Contig : 
gi|51003443|gb|CO787472.1|CO787472





Acknowledgements   Citation   Disclaimer